Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E038A12
Clone ID E038A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE038A12
Sequence
CTCTGAGTTATAGTCCTCCCATTGCTTTGTTTTGAAGGAATTTGAATTTTACTGGCAGATTTTGTCTGAGTGCACGCAAG
TTCTTTGCTATTCATGCTCTTGTGACCTTGGACTTATCCTTAACTGCGTTCCTTCCTTAGAGTTTCGTGATTTGTAAGTG
TATTTGCCCCGACCCCTTCAGCAAACATAACAATTCTGAAAGCTTGGGGTTGATGGTTTCCATTGTTTCGAGTGGGGCTT
GTTTCGACGTTTGTCAGGCTTGAGAGGGTGTGTTTGGGTGTGTGTATTTGTGAAGCAGAGACTGGAAAAGTGAGCAGGAA
GCCATGTGATAGACTGCTGTCCTG
Sequence Type genomic DNA
Unitrap ID UNI25096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27424805..27425148 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]


SPLK-Sequence tag 3SE038A12
Sequence
CTGACTGTTTCCAGCACATTTGCTTCTGTGTTTAGTGATCTCCATTTGTAGACATGGGAACTTTGGTTTCCCTGCTCCTG
CTGTAACTAAGAATGAACACCCTTAGTTCTAAAACCCCGCAGAAACACTTGCTCTTTAGAGCACTTTCAAAGTGCTGAGT
GTGCTAGGTAGAGCACTTGCCATACAGATAAATAATAGCTCCTCTCTGTCTTTAAGGTTCGGATTCCCACGTGTCATGAC
AAGCCTGGGACCACGCAGATGGTGCAGTTAACTCAGCAGGTAGCATGATGCTAAAGTGACCGTGGCGCAGCCTGGTCACT
GAAACACCCGTTACTTTTAAATAGTTGGTGATAAATTTTCTAACATTTCTTGTTAGAAATGTTGTTACTACCTCAGTAGG
TCCTGGAGAACCCCACGTTCATGTTGTAATTGTGAGGACTAAATGACAGTAAACACTTTAAAGAAGGTTTAACTCTGGCA
AAAGGTGTTCTCTTACAAGAATAGGCAACTGAATTCTAATTTTAGACCGTTAAGTCAGAAGG
Sequence Type genomic DNA
Unitrap ID UNI25096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27425146..27425687 542
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es