Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E037G05
Clone ID E037G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE037G05
Sequence
AGCCGTGGGTTCTTGTCCTGTCCGTGGATGCCTCCTTACCTTATCTGCCCTCCAACCGGAGTCCCCTGCAAGAATGTTCT
GCCACCATGTCTAAGTGTGTCCTGATTATCAATGTGTCTACAATCCACTTTCTTTCAGTACTATCTGTAGGACTCAACCA
GGTACCAGAGACCTGAGAGGCATTTGATAGAAAGTTCTGGATGTAGGATGGATGGATTAGCTAGTGGCTCCCTTCTTTCT
GTTTCTTCTGTGCCATCCTGTGCCAGTGCTGAGGTCTAAGGATAGGATGAGCATCTCCAGTGCCCAGG
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24334922..24335229 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es