Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex180
Clone ID Ex180
Vector pGT1.8TM
Project baygenomics

Sequence tag Ex180
Sequence
TGACCCTTACACGGTTTCCCATTACGCCATTGGAGAGGAGNGGGAGCGGTTGTCTGACGCTGGCTTTAAGCTCACATGCC
AGTGCTTGGGCTTTGGCAGTGGTCATTTCAGATGCGATTCATCTA
Sequence Type mRNA
Unitrap ID UNI10378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71639645..71639769 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es