Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E037B11
Clone ID E037B11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE037B11
Sequence
TAGATTTACTAAACAGCGCCCTCCCCCCATCCTCCCACCCAGCTAGAGTCAGGAACCCCCAATACCATTCCTGCCAGCTT
AGGCCCTCTCTGGGCATGTCTGAACAAATCCCAGCCGTTACCCACCGCACCTTCCACTTCCTAACTACAGCCTGCCTCAC
TGGCAGGTGGTGCAGTGTCTGAGCCACTT
Sequence Type genomic DNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140860174..140860362 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]


SPLK-Sequence tag 3SE037B11
Sequence
GTGTCACCACATCTGGTGTTGGAGGTCAAACTAGAGGTCCACGTTGGCTAGCACTCAGTTAACTTTATTTTTTGTGTTGG
TGGTGGTGGTCCACGGAGTTACCTCCTAAGAGTGGACTCCTCAACTGAGCCACACTGTTTCTAGGGCCGTGGAGTCTCCT
CTTACATCTGGAAACCTAGCCTGCCTAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es