Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E036E11
Clone ID E036E11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE036E11
Sequence
GATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCTTTCAGGTAAGCTACCCACCACCACTGCAT
TACACCTCCCAGCTTCAAGGTAAACTTCCGTAAGGTTGGTAATACACCAAGCACCATCTTTATTGTGTGGTTGGCCTCAT
TACCTCCCGGCACATGGTTGGAAGCAGACTGCCCATCTCGGGCAAGCACTGTCTTGGATTTGTGCTTAAGTC
Sequence Type genomic DNA
Unitrap ID UNI14517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153476580..153476811 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]


SPLK-Sequence tag 3SE036E11
Sequence
AAGTCCTACTATTGCAAAAGCAATTACNNNTTCTATCCATGTGCTTTAGTTGCTATAGAAGGCCATGTGCAATAGAAACA
GTTCACTAAGATTAGGGAGGAAGCCAGCTTGTGGGGTCTTCAACCCCCCCATCTTCAAGGTGGGATAAGCACTCAATGGC
ACAGCACCTGGAGTAGGCCTCAGTATGCGAATGTTGAGGTACGCTGGGCCGAGCGGAATGGAAAGTCACCCCTGCCAGCC
CCTCCTTTTCCTGCCTCCCCGAGGTACTGTGTTTCATTCTCAGCTATGGAGGCATTTCTGAACCATCATTGTCTGTGGCT
GGGGAGTTGGCAGGAAGGGCTGTCTTTGTTTCC
Sequence Type genomic DNA
Unitrap ID UNI14517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153476807..153477158 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]

 
Come back to gene ENSMUSG00000027478


For any suggestions or comments, please send an email to unitrap@crg.es