Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E036C12
Clone ID E036C12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE036C12
Sequence
AGGGCAACTTTTAGATTGACTTCTTTAATAGTTTGGTGATATTCTTTTGGGAACAAACAAAGGAGAAGCTAATCTGCCTC
AAGACGCTTGTAATATTTGTAGCATCTGCTTGGCTGTGTAGACAAACTCGATTCAGGCTAATGTCTGCCGTGTATTATAT
AACCCGAGCAAAGCTGTTATCATCTTGGGGTTTCAATTCTCTCAGTTGTCAAATAATACTAGTCTGTCTCCCTTAGTATT
ATCTATGAAAAGTGAATAAAAGAATTACATGCACTGTGCAAAGAGCAAAGTGCTCTGTAAGTGTAAGATTATCACTGTGA
GAAGCTGGGACTAGCCCACCTTTCACAGGAGGGGTTAAAGGGGTGAAGTAAGGTTGAAGTCGGTAAAACCATCCAGAACA
CAGAAAAATAAACGCGTGTCGTAAGTTTAGGTAAAAAGGAAGACTTAGAAACCGTTGGATGTCTCTAGTTTAGACGACGC
TACTAACACTAGAAACAGTTTCCAACTAGAGAAGACCTGCCGTGTGCTGGGCTCTTGCCATTTTCCATTCTCCTGACAGG
CAGTACGGTCTTCAGTGTTGTTCTCCTCATTTTATACACGGAGAAATGG
Sequence Type genomic DNA
Unitrap ID UNI29884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135229637..135230245 601
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es