Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E036C07
Clone ID E036C07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE036C07
Sequence
GATCTAAGTCCAACTGAAATGCTCCTCTGCCATTTTAGGACAGTTGAGGCTGTACTCACCGTAGGATGTTAGGGAGGGGC
ATTTTTGGTCTTGGCTCAATTTAAAAGTTCACGTTCCTGTGCC
Sequence Type genomic DNA
Unitrap ID UNI16356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17251673..17251795 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es