Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E036B08
Clone ID E036B08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE036B08
Sequence
CCTTGGTTATTTTGCAGTTTAGTTTCTTTTTGCTAGTGAAGATGTATTTTGTGAATGCTCCATATGTTGTGAATGCTCTG
TAAGACACTGTTATGAACTGTCAGCTCTACATTTGTTCTGAATTCCCCCACCTTGTCTGCCTTTTACTAGTCTTTAACCT
TGACTTTTAGAATACAAGTGTCCTTTGTCCTCTCTTGGCTGACTTATGTACAAAAACTCAATGTGTTCAATGCCTTCAAA
CCAGTGATACTAAATACTAGGTGACAAGGTTGTCCTGAGTGCTACAGGTGGCAGGGGCTTTCAGCCGAACGTCACACTGC
TAGAGTCCATTGCCTCACCTGCTGCTGCTGTCTGTGACCATATACACATACCTGTGGTGCCCCAAACATCGTTTCCGCAA
CAGTTTCCTCTAGATGTAGGTCAAGCTATAGTACCCTGAGAATCTCAGGAGGA
Sequence Type genomic DNA
Unitrap ID UNI8696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9142065..9142518 434
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]


SPLK-Sequence tag 3SE036B08
Sequence
CTAGCAGGTAAAATAGTACTTTTTGTATTATTGTGCGTATATGCAGGTGAAATCACTGAAATGCTGTACTGAATTACCAA
TGTGCTTGGTAAATTTTAAGCCATTTTTTTCCTGAGTTATTTATTACTTCTGTGTAGGAGGAAATGAGTCTCAACCAGAA
AGCCAGGAAGACCCTCGGGAAGTACTTAAAAAAACATTGGAATTCTGCTTATCTAGGTAAGGCTGTTAGTGATATTTTCT
AATGTCTGATATCTCTTGTATTACACATTGGCTATTGATTACAAATGTGATTTTTCATAGTAGTATGTTTATAAATATCT
AACTAAATGCCTGTCTACTCATCAGAAGTGCTATTGAGAACTGGTAGTGACCCCCAGGCCAGGG
Sequence Type genomic DNA
Unitrap ID UNI8696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9142863..9143246 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es