Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E035G03
Clone ID E035G03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE035G03
Sequence
GATCTGTCAGGGTGCAGGTGTTTATTATTACAATCTCCCATTTACTTTCAATAAATTTGCTTCTTTGTTTGTTTGTGTAT
GCCTTTGCGATGTTGTTT
Sequence Type genomic DNA
Unitrap ID UNI10394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107842056..107842153 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]


SPLK-Sequence tag 3SE035G03
Sequence
CCTTTTGGTCTGCAGGTGGGGGTGGGGAACAGACACGGCTGTTGAACAGCCAGCCCTGTGTGTGCTCATTTACGCATTCC
TTCTCGAACGCCTTGTCCAGTGGTCACTTGACACTGAAGGTGTCCAGAAAGCAATATTCTTGGTTCACTTTGTTCCTGCC
TCACAGCACTGAAGTTAAGACTGTTTAGTAGGTTTATAAATTATCTAGTTTAACTAAGGACCACAAAATAGGGAAAGTCC
AAAGTTAGGAACTTTACGGGGAAACACGACCAAGTTCGGAAGTGCAAAAATGACCACGTGGCTGTTCATCAGGTAAGATA
CCCAACGTGAAATCTGTTCTCCTAAGCTAAACATGATTTTGAG
Sequence Type genomic DNA
Unitrap ID UNI10394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107842266..107842628 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]

 
Come back to gene ENSMUSG00000035873


For any suggestions or comments, please send an email to unitrap@crg.es