Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E035F06
Clone ID E035F06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE035F06
Sequence
GTGGGATCCCAGTCGTTGGAGGTGGGACTTCAGTCAGTGAGTGGCGTGGCCCCTCTGCTGGAGACTAGGTCTAACATTGC
GGAGGGTGGAGCTGCAGGTCAGGGGGCGGAGCTTCACGCCGTAAAGGGTGGGGCCAAGGAGCCTTGCGCAGAGCTAAGCT
TGAGCTATGGCCGGGGGCGTCCACGCGGGGGCGGTCTCCGTGGTGGCCGCGCCTGGGGTCGCGGTAGACCGAGAACTCCC
CCTGGAGAGGTGGTGTGGGTGGAGCGAGCTCGGCGCCCTGCTGACTCTGAGCCAGTTTGGGTTCCCCGGAGGCCCCCAAG
AGCTCAGAGTTGGGGAGGTGCCCCTGGTGGAGGAGGCACGGGGCCGGACTGGGGGGTGCCCCCGGAGGACCGGGGCTCCT
CAGAGCCACCTAGTGG
Sequence Type genomic DNA
Unitrap ID UNI15560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7054106..7054521 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056629 (Fkbp2) NM_008020 FK506 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:95542]


SPLK-Sequence tag 3SE035F06
Sequence
GTGGAGATGTGTGGGTGCCTCGGGGCCGAACACCTGCAGCAGCCGCAGATGTGTGGGTGTGCTGGACAGGGGGCAGCTGG
GTGTGGCGGGAGTGGGGTCGTCCAGTCGGGACAAATCCGGTGCAATCAGATAGGGTTTGGACTTTGCGTAAAGGGGCTAG
CGGGAACTGAAGAACGGAGATGGGGACTGGGAGGGAGAGAAGGTCAGGTAGTGAGCAAAGGGAGGGGGCACTGGCTGCTG
TGGCCTCCCCTGACCCCCTCCCCTCGCTGCTGGGGTCCTCGGTCAAGCCCCCTTCTCACTGGACTGGTAAGTGTGGCTAC
AGAGCCCAGGGGAGGGGGTGGTGACCCAGGACTGTGGGATTCCCCAGAAACAGGCAAGATATAATGGGGAGTTGGCGTCC
TCCTGATACAGACTGAAGACGTCCCATGACTCCACCCCCCAGTTTTTTGGTTGGGGGTGGGGTGGCCTTTGCCTACAGAG
ACATGAGGCTGAGCTGG
Sequence Type genomic DNA
Unitrap ID UNI15560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7053613..7054109 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056629 (Fkbp2) NM_008020 FK506 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:95542]

 
Come back to gene ENSMUSG00000056629


For any suggestions or comments, please send an email to unitrap@crg.es