Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E033F06
Clone ID E033F06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE033F06
Sequence
CAGGTTTAGTTACCCAGGCATAGNNNAGCTCTCCCACCTTCCCCCCTGCATTTTCAGGTTTAGTTACCCAGGCATGTCAA
CTGTCACCACTTAGGATTCGTGTTTTCTCTTTGGGTTGGTCTTGGAAGTCTTCCTGCAGTTTTTTGCTTTAACATAATCT
CGTAGTTTACTACCACTAATACGCCTTTCTACTTTATTTCCAAGGTGCATAGTCTGCCTACTCTTTACTTTTCTCCAGCA
ATTGTGTACAGTAACAATTGGAGCTTTTAGGTGATTCTATGAGGTACCCAGAGATCATTTATTTGAAGAGCATGCCTTTT
TTTGGGAGGGC
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41221016..41221345 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es