Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E033D11
Clone ID E033D11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE033D11
Sequence
AGTTTACTAAGGGGTTTTGCCATTTAAGTCTTCCACTACACTTTACCATTTGTGTTTGGCCTTTGATATACAGTCTTTAT
TAGCAGCAGTCCTTTGGCAT
Sequence Type genomic DNA
Unitrap ID UNI5703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62253251..62253350 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020074 (Ccar1) NM_026201 cell division cycle and apoptosis regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914750]

 
Come back to gene ENSMUSG00000020074


For any suggestions or comments, please send an email to unitrap@crg.es