Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CT070
Clone ID CT070
Vector pGT0,1,2
Project baygenomics

Sequence tag CT070
Sequence
CTGCAGCCTCGCCNAAGGAGAAGCNGCCGAAGTTTTTCTCTGGATGAGCCTCCATTGTTCATCCCAGACAACATAGCTAC
TGTAAAAAAAGAAGGGTCAGATCAGACCACCTCAATTGAAAGCAAATATATGTGGACTCCAAGCAAGCAATGTGGGGTTT
TGNAAAAAACCACATGGCAACAG
Sequence Type mRNA
Unitrap ID UNI10382

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30886688..30886869 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es