Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E032G07
Clone ID E032G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE032G07
Sequence
GGGATCTCTTTGGAGGTGTTGGAGTAAAGAGTAGCAAATGCTACCCTTTGTGGGGGTGGTGGTGTGCGGCTGAGTCTCTG
GGCAGTGTTTTCTGTTTCAGCGTGCCTAATGGGACACAGCCAGTTGGTTTGCAGCATATTTAGCCACTGAGAAACTATAA
ACATTAGGAAGTATTTAGAAATTAATACTTTGAAACAGTTTCACATGAAGAGGCACTTTGTTCTGTTTCTCGTGCTGGGG
CAGTGCACTGGGTAGGCCTTTCAGTGCTGTGCTGGAATATACTGAACAACAAGCACGCGTGTCAGCCCTGCTTGCCGATG
TGTACCTGTAGCTAAGAAAACCTTGCCAACACTTCATGTGTCTTGTGTGCAATATGGCTCCCAG
Sequence Type genomic DNA
Unitrap ID UNI22778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42268863..42269246 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es