Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PT065
Clone ID PT065
Vector pGT0pfs
Project baygenomics

Sequence tag PT065
Sequence
GCTGCATGCTCTTCCCCCACATTTCTCCTTGCGAGGTGCGCGTGCTCATGCTCCTGTACTCGTCTAAGAAGAAGATCTTC
ATGGGCCTCATCCCCTACGACCAGAGCGGCTTCGTCAACGCCATACGACAGGTCATCACCACCCGCAAACAGGCCGTGGG
CCCCGGGGGTGTACACTCTGGACCTGTTCAGATTGTCAACAACAAATTCTTGGCATGGAGTGGTGTCATGGAGTGGCAGG
AG
Sequence Type mRNA
Unitrap ID UNI10384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52120283..52120993 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038502 (Ptov1) NM_133949 prostate tumor over expressed gene 1 Gene [Source:MGI (curated);Acc:Ptov1-001]

 
Come back to gene ENSMUSG00000038502


For any suggestions or comments, please send an email to unitrap@crg.es