Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PT084
Clone ID PT084
Vector pGT0pfs
Project baygenomics

Sequence tag PT084
Sequence
AAGATAAGGAAAAAGAGAAGCCTCAAATGGTCACAGTTAACAGGGATCTGCTAATGGCCTTTGTTTATTTTGATCAAAGT
CATTGCGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTATATACTCTTGGACTGCATCTTTCTCGGGCTCAG
Sequence Type mRNA
Unitrap ID UNI10385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62213295..62213443 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020074 (Ccar1) NM_026201 cell division cycle and apoptosis regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914750]

 
Come back to gene ENSMUSG00000020074


For any suggestions or comments, please send an email to unitrap@crg.es