Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E028F10
Clone ID E028F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE028F10
Sequence
GGATCTGCTTGGTGGCCTGGGCGACATGACCACTAGCCAGGCCAAAACTAAATCGTTTGACTCTTGGAGTTACAGCGAGA
TGGAAAAGGAATTTCCCGAGCTCATCCGAAGCGTTGGGCTGCTTACAGTGGCCACCGAGCCTGTCCCTTCCAGCTGTGGA
GCAGCCAATGAGGACTCATCTCAAGTGATCCTTTCAGAGGACCACAGAGGTGGACACGAGGAAGATGGCGCTCTTGAACC
TGGAGAGCAGCTGGGCTCAACACTGGAGACGTCTTCCTTAGGGGACACACTGACAAACGCTGCTGAACACCCTCCGGAGA
CAGCAAACCAAGACTCTACTTCCTCTCCGCAGCTTGGTGCGAAAAAATCCCAGCCTGGTCCTTGTGAAATGATGACTCCC
AAGAGATC
Sequence Type genomic DNA
Unitrap ID UNI29899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 53987421..53987828 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061603 (Akap6) NM_198111 A kinase (PRKA) anchor protein 6 Gene [Source:MGI Symbol;Acc:MGI:3050566]

 
Come back to gene ENSMUSG00000061603


For any suggestions or comments, please send an email to unitrap@crg.es