Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E028E03
Clone ID E028E03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE028E03
Sequence
GATCTGTGTAGGTCCTGGGAGTAGACAGGTGGGCAGTGGGAGTACCAAATGAGGCCACTGCCTCTGTCTAGGGTCCAAGA
GTCCAAGAGAAAAACATTCTCCCTTTTCCCTTCTCTGACCAAGTGGGTAAGAACCTAAGGTGGCTCTTCAGTCCCAGTAC
TCACAAGCAGGTAGGGTGTGTGAGATGGAAACACCTTAGGAATACAGTCAGTGAGAAAAGCAGGCAGACCTGGCTTGGGT
GGGTTTGGGGTTCATTTCTGGTTTTTGGCTGCCACGATAATCCATCCAGTTCACCTGCTTTGTTCACCTCATTAATGGGT
ATCTGCCTCATTGGGGTGGAGGGGAGTGTGC
Sequence Type genomic DNA
Unitrap ID UNI29900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181115540..181115890 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027582 (Zgpat) NM_144894 zinc finger, CCCH-type with G patch domain Gene [Source:MGI (curated);Acc:Zgpat-002]

 
Come back to gene ENSMUSG00000027582


For any suggestions or comments, please send an email to unitrap@crg.es