Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E028C09
Clone ID E028C09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE028C09
Sequence
TACCATGGTTCTGGGAATGCCATCCNNNNGAGTTCTGGCAGGAGTGAGCCCAGCCCTGCAGGTGTCACTGTTACCCCCAT
GAGTGCTAAGGAAGAGGAGGGAGGCTGCTACCCACCCAGCTTCCGTGTTGGTGTCTTCCTACTCCCTCTCCCAGGCTGCC
CTTGTGAGCCAGTCCTCTGAGGAAGGGGAGGCTGACACTGGAGAGGATGAACAGGGAGGTACCTAGGCCAGCTCCAGAGC
CAGGAACAATCTGGGCTCACCAGGAAGGCTGCAGGGGAAGGACTGCCCGTACCCCTAGAGGAGGCAGCAGGAGTAAACTG
AGACCTCTAGCCTGGTCCGGCCACGCTCTGCCCTAAGGTGACTAGAGATGATGGCAGGGAGATCAGGTTTCCCTGGTCAG
ATGACACAGAGCCATAATCCTGAGCTCCCCTGAGGCCTCTAGAACCTACTCCATAGGCTGGGGAGGTGAAGCCAGACCTG
CCAGAGGGACCAAGGAGCCTGCAGGAGACACGAGGGCCACCAAGGCTTCTCTGCTTCGCTTTAGCTTGTGGTCCCCCAGA
GGGCCTGTGCCTCTGCAGGAGCGCTGTGCTCACAAGAGGAAAATGGGAGCTGCTGGTCAGCGTCTCCAGGGAAGAAGGGG
AAGTAAGGTCCAAGAATCCATGAGTCCTGGGCTTAGTAGG
Sequence Type genomic DNA
Unitrap ID UNI8560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86600621..86601300 654
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031706 (Rfx1) NM_009055 regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]

 
Come back to gene ENSMUSG00000031706


For any suggestions or comments, please send an email to unitrap@crg.es