Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E028C04
Clone ID E028C04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE028C04
Sequence
CCCCAGTATAAGAAGTCCCNNNGTGGCATCTGCGAGCCAGTGGGGGACTCCAGAGAAGAGATTAGGAGTGGGGTTTTGAA
TGACAAAGGAAGACTTAGCTTTCTTCGCACTTACATAGATAGATAGATGCGCCTCCAAGTTAGCTTCTGGGAAAAATAGA
GAAAAACACAGTGAGTGTAATGTAATCGAGTGTGCCTCTCAGCAGGTCCGAAACGCACCTCGAGGTAACGGGAAATTCCC
GCCAGCAGGAAGTCAAACTCTGACATTAG
Sequence Type genomic DNA
Unitrap ID UNI4710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55283923..55284191 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]

 
Come back to gene ENSMUSG00000018583


For any suggestions or comments, please send an email to unitrap@crg.es