Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PT193
Clone ID PT193
Vector pGT0pfs
Project baygenomics

Sequence tag PT193
Sequence
TTGTGCCACAAAGTCAGGTGCCTAATNCCCGAGTCACCTGGCAAGTCCTTTCAGCCAATCACCATGAGCTGTAAGATTGT
CTCAGGTTCTCCCAATATCAACTCCAAGCCCATCACCATTACCTCGCACACCAACTTCCACTCCAGTTCATTTGAAGCAA
GGCACTGCCAGTTCTGGTGTCAGCAACCCTCATGTTATTGTGGATAAGCCTGGGCAGGTCATTGGAGCCTCCACTCCAAG
TACAGGAAGTCCTACAAGCAAGCTCCCAGTGGCCTCTCAGGCTTCCCAAGGAACAGGGTCCCCTATTCCTAAGATTCATG
GAAGTAGTTTTTTGACATCTACTGTGAAGCAGGAGGAGTCTTTATTCGCATCTATGCCACCTCTTTGCCCAATTGGTAGT
CACCCTAAAGTGCAGAGCCCCAAAGCTGTGACTGGAGGACTTGGGGCTTTCACAAAGGTGATCATCAAACAGGAACCTGG
AGAAGCTCCTCATGTGTCCACAACAGGAGCTGCGAGCCAGTCAGCATTCCCTCAGTATGTGACCGTGAAAGGGGGTCACA
TGATAGCTGTGTCCCCTCAAAAGCAGGTCATAAGTGCTGGAGAAGGGACCACTCAGTCACCAAAGATTGCACCCTCCAAG
Sequence Type mRNA
Unitrap ID UNI7927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20186480..20193899 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es