Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E026B04
Clone ID E026B04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE026B04
Sequence
CCCACAAATGGAATCACCTGTGAACTTCCAAACCAAACNNNNTGGCCTCCCGATGAGTCTTTGTGATTCGCACAGCACAT
GGTCACGTGGACTACACATGCTTAGAATGAAAACTAGTGCCAAGATTTCTGGATTTTTCATTTAGTTATCTTCATGTTTA
GTCTTTGTTCTAAACATAGTCTTGAGTATTTTGTGCATCTTTATCCTGTTTTTGATCATTTCAGTACTGGCAGTCCTCGT
GGGATAGCGCTGATATACTTAAATCTGTGTTGGTTTCTTCCTGTCCTGCAGTCTTGCTTTTCTCATTGTTGATGATCGCT
TACTGTAAACTTACATTTACTTGCTCTTCAAGTGTGTGGATATTGAGAGCCTGAGTGGGATATAATGCATTTATCTCTTC
TACTGCTGGGAGCCAGGGGTTGCTATAGCCTGGAACTGTTTACTCCCTGGCTGTCCCAGCACTGAAAGTTTACTTAAATG
ATATGAAGAAATAGGGCACCAGCTTAAATTCCAATGCATCATTTCCATAATAGGGCAGGACCTAGCTCAGAGGTCATCCT
ATTCTAGAGTCAAGGCATTTTCTATTCTGTGGTATATTTCTGGGGCTAACCTAGTTGGGTGGTAGGTGGGTTTTGTTTGT
TTTTGATAG
Sequence Type genomic DNA
Unitrap ID UNI11943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70773841..70774489 631
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040667 (Nup88) NM_001083331 nucleoporin 88 Gene [Source:MGI (curated);Acc:Nup88-001]

 
Come back to gene ENSMUSG00000040667


For any suggestions or comments, please send an email to unitrap@crg.es