Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E025G12
Clone ID E025G12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE025G12
Sequence
GCTTGAGAAAAATTTGAATGTGNNCACCTTAGTTTGAATAATCTCTTCTGAAAACCACGGTTGCTTTTTCTCCTGCTTTC
TGGACTGTAAGTCTGCCAATCTCCCCTTTGCTATCCAAAAGTTTGGTTGGCATGTGTGTGCCCGAAGAACTGTGAGCATG
ACTAGTATGCACAACAAAGCTTTTCTTTTTGAAACTTTAAGCATGCTGAAGTTATGCAGAAACGGAGAGAGAGTTGCAAC
CAGTGTCAACTATCTCAGAGTCTAGTGTGGCCTGTTTGAGGTCGTCTTTTTTTGATAAGGCAGGTCTCTATACTTCTGTT
TATTTCTGTGG
Sequence Type genomic DNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160513139..160513470 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]

 
Come back to gene ENSMUSG00000040749


For any suggestions or comments, please send an email to unitrap@crg.es