Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E025E05
Clone ID E025E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE025E05
Sequence
CCTTCATGCCTCCTCCCCTACCCTTAAAGAACTGTAAAACTAGGGTGTGCTCACTGGACACAATGCAGTCCTGAAGTATA
TAAAACAAGCCAGAGCTGGAATAATGTTGCTCTTCAGTTTTATGTACATCCTTA
Sequence Type genomic DNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4706094..4706227 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es