Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E025C07
Clone ID E025C07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE025C07
Sequence
ATAGATTGTTTTTGTGACATAAACGTGATCAGGATGAGGCAATTGACTTTGAAGATGTTGCTGTTTGCAGGTGGTAATTA
CTCATTGTTATTACCCCCAAGTGTCTGACTTGATGCTTAAGATTTATTTTTAAAGATAAGTCATCTGGTTTATAGCTTGC
TTGCCTGTTACTTGAAAGAGTTAAATTCATACACTTCTTAATATATGCCATTAGGAAGGAAGGGGTATTTGTGTCACTTA
AAAAGCCTGTCTAACAATGTTACTCGTTTGTCTCTTTAAAGATCACTAACTTGGGGCATACCCTACTGGTTGGACAAG
Sequence Type genomic DNA
Unitrap ID UNI1364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21712456..21712773 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035171 (1110059E24Rik) NM_025423 RIKEN cDNA 1110059E24 gene Gene [Source:MGI Symbol;Acc:MGI:1913456]

 
Come back to gene ENSMUSG00000035171


For any suggestions or comments, please send an email to unitrap@crg.es