Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E024C08
Clone ID E024C08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE024C08
Sequence
CTTGTTGTGCCCAGAGGGCACAGTGGCAAGCAAAGCAAACAGGCTCCTTGCTGAAGTTAAATTTCCATAGAGACATTAGG
CGAAGCAAAACACAAATGCACTAACCATTAAAATTGTGCTTGCTGGGGGGAACGTAATGGGCTATTATCAA
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30472324..30472474 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es