Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E023E10
Clone ID E023E10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE023E10
Sequence
ACTAGTGGGACCTGAGTGGGTGGCCTTCAGGCCTGCAGGGTAGTGGTTGTGCTTCCTGGAGAAGGTAGCAAGGAATTTTC
CAGATTCAGAGTACCTTATACAATGAAAGGTGTTTTATATCCGTGAGGTCACCCTTCACCTTCTGCACATGACTCTCAGA
GGTCAGCGGCATTCTGCCCTGGCCCCTGTTTGGGTTGAATTCCAGCCAACAAGTCTCCAGCCTACAGGAGAATTTGAGAT
TTTTCTCCCTCCCTCATTTCTTCTGTTTTGTTCTGTGTAAACAGTTCCTGCCAAAGTAACATAGACAAATATAGCAGAGA
ATGCTTTTCTGGAAGATGCATGCTCCCAAAGCATTTTTTAACCATTTTTGGGAAGAATTGATCGTTCTGTGCGTTTCAGA
CAGACTGAAAGAGGCGGGGAGGCTGTTGCTATAATGGAAGTGACATCATACATTATTGCCCCATTGATCCGCTTTTAGTC
TCCAGCCAGGAT
Sequence Type genomic DNA
Unitrap ID UNI14617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63379702..63380193 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021458 (2010111I01Rik) NM_028079 RIKEN cDNA 2010111I01 gene Gene [Source:MGI Symbol;Acc:MGI:1919311]

 
Come back to gene ENSMUSG00000021458


For any suggestions or comments, please send an email to unitrap@crg.es