Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E023D06
Clone ID E023D06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE023D06
Sequence
TGAAAGGACCAAAGATAAGAAACTCAGTTTTCTTTGATTTACTAAGTACAGTTGAAATGCCCCTTTACCATAGGCAGGTG
ACACCATTCCTGTTGCATGATGTGTATGACCCAAGGCTGGGTCACATTTTGAGTCAATCAGATTTAGAAGGGTGTACATA
TCGGTCTCTGCCTGCACTATGTAGCTTCTGCCCTTCATTCCCAGGTGCCCTGGTGCCCTCCTCTTTAAATTTCCGGTGGC
AAACATTTGCCCA
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25698858..25699110 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


SPLK-Sequence tag 3SE023D06
Sequence
TTATTTACCTTACGATGTTNNCTAGGTATTTTGCCATCTTATTTCAGACTGAAGAAAAATACTTTCTTCTTCTCTTTTTA
CACTTCCTAAGAG
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25699115..25699207 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es