Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E023C07
Clone ID E023C07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE023C07
Sequence
CGTCTCATCAGGACTCATGAGCTGACCTGTAATAGTCCTTCCTACTCACCACCTTTTAACTTTCCAGCTGTCCCCCACCA
TTGTGTTAATAAAGTTATGCTAATCTCAGAAAAGTTTTAAAAAGTCAGTGCTAT
Sequence Type genomic DNA
Unitrap ID UNI1968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126538800..126538933 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040462 (Os9) NM_177614 amplified in osteosarcoma Gene [Source:MGI Symbol;Acc:MGI:1924301]

 
Come back to gene ENSMUSG00000040462


For any suggestions or comments, please send an email to unitrap@crg.es