Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E022G06
Clone ID E022G06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE022G06
Sequence
TCTTGTTTGCTCTGTGTTGGGAAACNNNGCCTAACCAGTTCCCTCTGGGGAGTTGCTTTTTCATTGTATTTCCTTGCTTG
TTAAGTTTAAGGTGCCACAGTGGCTGCGCTAGGTGCTCAGGACTTCTTTGG
Sequence Type genomic DNA
Unitrap ID UNI19903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97997588..97997717 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000881 (Dlg3) NM_016747 discs, large homolog 3 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg3-003]

 
Come back to gene ENSMUSG00000000881


For any suggestions or comments, please send an email to unitrap@crg.es