Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E022F09
Clone ID E022F09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE022F09
Sequence
GGTCCTTGTTGAAGGTAGCCCTCCCTCTGGAAGGGAAGAAAGGACTTCACCCCAGCGGGAATTTGGTCCCCTTCTCTTAG
CTTGGTGTCTTTGAAGCTTAGTTTCCCCAAGAGGGAGGGATGGTGGTCTATATTGGTCTATAGGGGGCCTGGTGCCCTGC
AGG
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4605456..4605618 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]


SPLK-Sequence tag 3SE022F09
Sequence
TCTGCGCATGGTCTGCAGTGGGCGCACAATAGCAGTCATTGTCTTGGCATGGCTGGCTGGAGGCGCCCAGCCCACCCTCA
AGGTGACCCCCGCTCGGTCTGTGGGAGGGCTGTCTCCACCCCTGCCACCCCGATGGTCTCTGCTCTTCCTCCCTTACTGC
TGCTTCCTCCAGCTCCCTCTGCTCTAATTAGTTCCTTTTGCAGCTGGAAGAGCCTCCTGGTCTGGCCCAGCACCCTTTGG
GGTTGCTGCTGCGGGTTCCCTTCATGGCCCTTGCAGGTGGGTGTGTCTCGGGACACACCTAGCCTACCAGGAGTGAGTGC
TACAAAGCATGGCCTTTGGTCCCTGATCGCAGCCCTGCAGCCCAGGGTGAGAGTCACTCAGCCATCTGACCAGAAGGAAA
ACAGGCACAGGTGGTTTCTCCGGCAAGTCTTTCAGGCGGGTGGACTCCCTACCCCTGGGTATTGTACCCATGAGAGAGGG
TGGTATCCCGTCCCTTTGGACCAGTAAGTTCCGGAGACCCACTGGTTCCAGATATCCTGAACTATAAGGGCAAGCTGCTG
CTGGACCTTGGCTAAGGAGGTGATGGCTTCACTTTTCCCAGGATCATGGCCTGCCATTGTCCTTGTTCCAGGCATTTAAG
TCTGGCTGGAGAGCTGAGCTGCAGAGTCAGTTAGAAGAATGGGGGACCTGCCTTTCTCCTCCCCCTTCATCTAGCTCTAG
GACAAAACCAGCTGAAGCCCAGATAGCTGCTGCTGGCTNNNAGTAGGAGTGAAGAAGTCTTTTGAGTTGGCCATGGTCAA
AGCA
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4605637..4606442 761
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es