Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E022E05
Clone ID E022E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE022E05
Sequence
ATAGGCATGTCACTGTCCCACGCTAAGCTATATCCCAAGCCTGTGTGTGTATGTTGAAAATTTAAACTCTTGCCCTAGCA
ACTGAAATGTGCTTTGTTTTCTCTTTGATATATTTATCTTTTTGCCAGATTTCCATGTTATGTCTCTGAGATGCTTTTTT
AAAAATGTGGCCATTTCAAAGTACTTTCAAGCTGTTAATTCTCACCCCACAGCTTTCCCATGTGCCTTTATTTAAAGAGC
ATTTAATTTCTGTTCCCACAGTTAAGACAT
Sequence Type genomic DNA
Unitrap ID UNI14923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44387655..44387924 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es