Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E022D09
Clone ID E022D09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE022D09
Sequence
GATCTTTATGTGATGAGGATCGTTCTTCAGGATAAAAACACGTGGGGCACTGACTGGAGTAGGGGGTTGCGGGGAAGACC
CGGGGAGGTGGGTCCAGTCCATGACTGTCACTGTGCAGTGTGACCTTGAGTAAGATACTGGATGGTCCCTGGTCCATGTG
AAAAATAAGGACATTTCTCTGTTACAGGCCCCTTTGGATTCTGAGGTTGAGTTTGTTGTAGAAACTTTAAATGAATTTTT
ACTTGTATAGTTCAGTGGAATGCACAAGTTATTAGAGCAAAAGCTGCAGGAGAAACTGCCCCGTGTCTTTCTCTTTGCCC
AGCGTATTTGGCCCAACCTAACACTTGTTGAATGAAAGAAGGAAAGACTTCTAGACTGGTTCTAAGTCTCGTGGGGAGCT
TTGTTCAATTCCCAC
Sequence Type genomic DNA
Unitrap ID UNI29912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155755123..155755537 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]


SPLK-Sequence tag 3SE022D09
Sequence
TAAATCCTCCTTAGAGTCACTACTGACTTCTAGGACGGGTTAAGAAAATGACAGAGTGGAATCGGTCCCTACTCATGAAG
ACATGGGCAGTTTGTAATTTAAGTCAGGC
Sequence Type genomic DNA
Unitrap ID UNI29912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155754985..155755093 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es