Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E022B09
Clone ID E022B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE022B09
Sequence
GATCCCCTGGATTTGGAGTTTCAGGCAGCTGTGGATTCCTTGATACAAGTACATGAAACTGAACTCAGGCCAGTCTTGTA
GACCAGTGGTTCTCAGCCTGTGGGTCCTAACCCTTTTGGGAGTTGAATGACCCTTTCACAGGGGCCACCGAAGGCCATCA
GAAAACACAGATATTATGTTACCGTTCATAACAGTAGCAAAGTTAGAGTTATGGAGTAGCAAAGCAATAATTTTATGGTT
GTGGAGGTCAGTACATGGTGAACAGTTTTAAAGGGTCGCAGCATTAGGGAGGTTGAGAGCCACTATTCTGGATTATCAGT
TCATGCTTTTAACCACTGAGCCATTTCTCCAGGCCCTGGTTCAAAATTTTAATAT
Sequence Type genomic DNA
Unitrap ID UNI1455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104159712..104160086 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054574 (AC145736.4-202) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8BNL1]


SPLK-Sequence tag 3SE022B09
Sequence
ATATCTTCAACACATTTTCCTTCTGGAGCAGTGTACTTCTGCTGAGTACATGCCAGCCATAATCCCTCTTGTTACAGAAA
CTGATTCATCGTCATGGGAACTCCCCAGAGTCACTGAATTAGGGAATATTCTTTCAGCAACTAGCTGAAGCCAGGCTATG
GTAATGGTCATGTTCATTGACAGAAGACAGACACAGTTACCTGTGAGAGGTTCATTCAGTGTGGCAATACTTACACTTAT
TTCTGTGTGCTCTTAACTTCATTCAGCAGCCCATACACTGTCATGGACTGCTCATGAAACATGTGATTTGTAAAACAGGG
TCAAAAAACAGAGGGCTTTCTTGTTTTGCCTTTGGTAGATCACGCCCTCTGAGTAGTAAGTAGCTCATGTATGTAACTGA
GGACTGGTTTGCACTTGATTNNNAGGTAGGAAAGCAAACACCTAAAGCAGTCTGTAGTAATTATTCTAACGCTCTGCCTT
TACCTGTAGGTGTCAGAGCCTAAAGAGCTGCTCAGGTCCGTTCATCTCACGTTTTGCAGGGAGCAGGCTTTCTCTAATAG
Sequence Type genomic DNA
Unitrap ID UNI1455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104159156..104159715 554
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054574 (AC145736.4-202) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8BNL1]

 
Come back to gene ENSMUSG00000054574


For any suggestions or comments, please send an email to unitrap@crg.es