Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E021F05
Clone ID E021F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE021F05
Sequence
GATCTGCTCATCTAATGGAAGGAAAGGAAGTGTGCATTCATAGATATTATTCACTATTTTATATTCCTTATTGTCACTTT
CAATAATAAAAATATGTTCCTGTGTTTGGGGAGGGAAATTTATACTAAAGGAAGCTACTTTAAATCAATTTTTGGAAACT
ATCTTTGGGGGAAAGCTGGAAATGAGAGAAGAGATGTACAACTCGTGCTCTACAGATTGATGCTGGGTTATTTGTGAAGT
TAAGGGAGCCAGGGTAGCAGAAGCACGGGTCTTCATGGGGTGCGGGACCTGGGGAAAGCATTGAAACAGATTTTCCGTGA
GTACAGGGCTAGTGCT
Sequence Type genomic DNA
Unitrap ID UNI9316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30916919..30917254 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es