Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E021E06
Clone ID E021E06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE021E06
Sequence
TCTCTCAGCTCCAGTCTTGCCCTGTCAAAGCCCCTGTGTGTGGCTGTCTATCACTGAGTAATGACAGGTGCATGGTCTTA
CCCTTCGTGCCCTCCAGGTGCCTACCCTAAGCCTTTGGGACTTTCTAGAACATGCACTGTTCCTGCCTGTTGGAGGTTGG
GGGTGACAGTCTTTGTAGACCCATTCTGAGGCTTCCTTTTTTTTTTAAATCTTTATATGTCAAATGAGCTTGGAGATGGG
TGGGGCGAGCTCTGTAAAGCAATTGAACGTCATTGGTGATGACTCCATCTTGCTGTCCTTAGGATGACGTCACTGTTCTG
TCTCCTCGCTGGTGATCATTCCTCCAAGAAGCTCTTTCTAATTCCTACTCAGCATTTTGGCCACTCCCACATTCTATCCT
ACATTCTATCCCCTCCCCCTTAAAGACCTGAGGAAGTCTGGTGAGCCTGTAGAGGAGCCATCCTGCCCTTGTTCTCATCA
CCCAGCCCATTCCTTTCTTCCCATGCATGGTCTTGGAATGTCTCTTCCTTGGTAGTCTGGAAGACATCAAAAGGCTGAAG
TTAACAGAGT
Sequence Type genomic DNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45182891..45183458 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]


SPLK-Sequence tag 3SE021E06
Sequence
AGAGACAGCTATGCTGAAATATCAGTTAACTAATTACAC
Sequence Type genomic DNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45183625..45183663 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es