Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E021D08
Clone ID E021D08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE021D08
Sequence
TAAATAGAAAGTAATCAAAACGCTTATTGAACAGGATAGGTGTTCTTTTATCAGGTACCTCCCTTTCAGAAAATCAGGTA
CCATGACAAAACTGACATAGCAAGAGTTGACTTTCATGCATTTTATTCACCTAAAAGCAATAAAACTTCAAATAAGTACA
ATTAAGTGTCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE021D08
Sequence
GAGGCCGCTTTAGTTATTCTGTGTAGTTGCTTGCTGTTTTAGCTGTTGGTTTTGTTACTTTATGTTGATGTAATGGAGCG
CTGAAGAAGAGATTGCATCTGTGCCAAGTTCATGTCACAGGAACTTTGCCTCATTGTAAAGGCAATGTTTGTGATTCTGT
CCTTGTGTGCATATTTACAGGAAATTTTAGTAAG
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916743..32916936 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es