Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E021D07
Clone ID E021D07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE021D07
Sequence
AGCTGTGACCGCACAAAGATTGGGCATTGAAGAGGACTGACAATGGAGGTGAGGGGAGCCCTGAACGCCTGCTGAGGTCA
GCCAGTCCCCCCAGCAGGTGTGGGGTGGAGGCTGGCTTTCCCTGCTCCTGTTGGTACAGGAAGGTTGTAGACGCAGTGGA
CAGTCTACAGCTTGGTGTTGGGAGGCGTGGGGTCTTGTGTTGCCGTCCTGCTGAGGC
Sequence Type genomic DNA
Unitrap ID UNI23228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97526807..97527023 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]


SPLK-Sequence tag 3SE021D07
Sequence
CGTTGCGCTACGAGCTCATGCGTGAGATCAGCCTGAGGGTTGCTCATAGGTCACATTTTATTAAGTTTATAACACATGAC
AGGCACAGTACAGCAGGTACCTAGTGCTTGCCGTTAATCAAGACAGAAGTGTAAACAGGCTTTGAGATAGAGGATACCCT
GTGAGGCTTGCTTGGGTATCTGGTGGTCATGGAAGGAGACATTTAGGTTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es