Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E021C12
Clone ID E021C12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE021C12
Sequence
TAATGGGTTTGCTGATTGTTTAGAGCAATTTGGAAGCTCACTGGACCACTAGATTCTTGTTCTTTATTTTGTAGCAGATG
GGGAATTTACTGGGGGGCTATTAGTTAAAGTCAGGTGACCTGGGGTGCTCTGGTTGTTAAGGGAGGGATATAATGGGTGT
CACTTTTNNNTGAAACTGTTGAGTGCATCGTAGTTATCAATACTCACGGTAATTAAGCCTTATGTTGGAGCTAGCCGCCG
CCTCCCTCCCTGCCTTCTTTATTCTTTCCCTATTCTCTCTCTACTAAATCAACAGCTTCATTCAAAACTTGTTCTTCCTA
GGGCTGGCTATGATGAGCACCAAGAGGAGGAGGGCCTTCATGTGTATCAGTTTTTCTTAGCTCAAAATGAATCACGCATC
GGTAGTCCAGTGAACTTATTTATGGGAAATTCCAGAAGTTAACATACTGTCTGAGGCCAGTCGGGTTCTGTTATGCCCTT
GCAAACTGTTAAGAGCTCGAATGTTAGTGTAAAAGAATCATTGGAACTTTGACTATTTTAGGATTTAAGAAAAGAAAAAA
AATCTTTAGATTCTTTTTTACCTTCATGTTTGGTTGATGTTGATGATGGATGGGA
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21864821..21865435 595
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]


SPLK-Sequence tag 3SE021C12
Sequence
ATGTCACCACACCAGGCTAAACATTCATACTGAGTGCATTCAGAGTCTGTATGTAAGTAAGGTTATGGGAAGAAATGGTT
AAACTGCTTAACCACGAGATAGCCCCATCCGGGGAATTGAACATCCAGACTTGAATGCCTGTCTGTTGGAACTTCCTAGG
GCATCTGTTGGGTTCTCATGGGATACACGGACTTGTAATTTCAGTTTAAAGAGTTTAGGGTTGTGAGGCTCCAAGTGTGG
TCACCAGAGTGTGTTTTATAGACACACATTTTTCTTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21865985..21866266 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es