Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E021B08
Clone ID E021B08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE021B08
Sequence
ACCTGATGTTTTATAAACATTNNNTCAATAGCAGCCAAACACTAAGAGACGGAGAAACTGCCCAAGGCTCCACAGTGAGG
AAGTGACCATGCCTTGCTGCTGACTCTTGTCTTCTGACTTTTGTGCTGGCCAGAGACTAGAACCTTTTGAAAGTTAGACA
CCAGCATGGGGCACAAAGTAAGATGAAATACAGTAACCTCTCCAC
Sequence Type genomic DNA
Unitrap ID UNI28258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166883297..166883501 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]


SPLK-Sequence tag 3SE021B08
Sequence
AGGCAAGTGTACTACCACTGTCTAGGTCCCACAGACAACACACACACACAGAC
Sequence Type genomic DNA
Unitrap ID UNI28258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166883112..166883164 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]

 
Come back to gene ENSMUSG00000039501


For any suggestions or comments, please send an email to unitrap@crg.es