Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E020H02
Clone ID E020H02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE020H02
Sequence
GAACTCGACCCAGAGTGACCTGGAACGAAAGAGGGAGCACCGGAAGGAAGGCATGTGTGAGCTGGGGGTAGAAGCATCCA
CATCCATTAAAGTCCGATCCCTGGAGAACAGAGGAGCGGTGGGGAGGGTACTCAGAAGACTTCAGTGTTGTGGACGTGGT
CACTTTAGGGCAG
Sequence Type genomic DNA
Unitrap ID UNI18902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125642226..125642398 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es