Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E019F01
Clone ID E019F01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE019F01
Sequence
CTCAGCAGCAATCCACAGCCCATTCCCCTCATCTCCTTCCCAAAGTCATAACTATATATAGTAAAAATGCACGGGAGTAT
GCACTGTTTAATTGGGC
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59536761..59536859 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


SPLK-Sequence tag 3SE019F01
Sequence
GGGCCACCTGGCATCAGGGTTAAAATGTGCTCCATCTGTATTTAGTTTGCAGATGCTTGTGAGTTATGCTCCAAACCAGT
AACCTTCCAGAAAGGTTTTTGTGGTTTATAATTAGTGGCACCTGTAAAACATTTCTTCTAACCACGTAGCTTCTTTCTTA
TTAATCTTTGAGATTTCATGGTTTCTTTTAGTTGTTGTTTTTTTTTGTGTGTGTGAATCAGGGCTGGCAAAGTATATCAC
CATGCCAAAGGTCTTACTACCATAACCTAATTAGATGTGGAATGCTGGGAACGCACTGCACGTGGCTGTTGTCAGTTTTA
TAACATGACAGTGAACTTCTGATGTCTTCACTGAACATTATAAAGCATTCCTTGTGTCTCTACTGCTGTTCCCCACCACA
TGTCTATTCATAGGAAACTAACATAG
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59536856..59537281 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es