Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D188H04
Clone ID D188H04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD188H04
Sequence
GATCTCTGTGGCACCAGCACACATGGCATACATTCA
Sequence Type genomic DNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72511775..72511810 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 3SD188H04
Sequence
CTTTAGAAAAACGCCCATCTCTCGGGTCACATTTAAAATATGGTCACAGGCAGATACAGAGGGCTCTAGGTACTCAGAAG
CAGCTCTCCCTCTCCTCTAGCGGGGTGTGACTGTCTGCGCAGTGCCCTCTATTTCATAAGAGTCGAGAGTTTCTGTTGCT
CTGTGGATAAGATGTCTTTTCTCTACCGTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es