Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D188E09
Clone ID D188E09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD188E09
Sequence
GATCTTGTGAGTGCCCAGGGTAACCACCTTTACTGTCCAAGCTTCCCATGAT
Sequence Type genomic DNA
Unitrap ID UNI581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7996101..7996152 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]


SPLK-Sequence tag 3SD188E09
Sequence
GATGACCTTGACTCCTGTTAATCCTCCCGTCACTGGTTACCAGTGGGTGTCACCATGTCTAGTTGAGTGCATTTTTAGAG
TGTTGTTTTGACAGACTCGACTTCTGTAGGCTCTTGTGACTGGAATATGGAGCTGCCTTTGAAGAGAGCATGGGCAGCTG
TCAAAGAGGTGGGGCAAGAGAAGATGGGCTTTTTGTAAAGAAAAAAAAATAGTAGTCATTTTTTTTGCATTCATGGCACT
GCCCTCACTTCCCTTTCTCCTTCATGAAACGGACAGGCGTGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7995817..7996103 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es