Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D188D12
Clone ID D188D12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD188D12
Sequence
AGCTGCAGATGGGGATTTTCTACTAGGGACTGTGTTTATCTGTTTGTTCTGGTTATGCCTTTGCCTTTGAAGTCTTTCTA
AGAGATACTCCTGCTCCTCAATGCTATCTTATTTATTTATTTTTCCTTTCATTCTTTTTCCAAAGAACATTGAAGAATTG
TAAAGAATTGTATGTTTAACTTTTCAGTCAGAGTTACCTGTAATGTTTGGAGCTTTCTGTTTGAGACCTTTTGAGTTCTC
ACTTTAATTTTGCAATTGATTGCAAAAAGGGGGAAAGAAATCTCAGGCTGGATGCTGAGGTCCAAGAAGCACTTGTTAAT
AAGAATCTGAAGAAGAGAGTCCAGTAACTTGACCATTGTTCCTCAGAGGTTTTCCCTTGCCTTAGTGGTGAAGGTATGTC
CATGGACTGCAAGGGCAGTATGGGACTTCCTCTCTAACTCGTCAAGAAAGGGGA
Sequence Type genomic DNA
Unitrap ID UNI14535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47388318..47388770 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es