Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D188B12
Clone ID D188B12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD188B12
Sequence
GAACTAATGCGTGCCCCTCTCTGGCCTTCCCCTCCCGGTCCTTCGGGGCTCAGCGCAGTGCAGCGCAGNAAATGGCCTCT
CAGC
Sequence Type genomic DNA
Unitrap ID UNI29934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44769646..44769729 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]

 
Come back to gene ENSMUSG00000035649


For any suggestions or comments, please send an email to unitrap@crg.es