Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D188B08
Clone ID D188B08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD188B08
Sequence
CAGACCCTGCTGGCACAGACAGACCCCGACCTTGCACTTCTGCAGTGCTTCTCCAGGACCAGGCTTGGAGCTCACCGTGG
GCAGAGCCAGGCCATGTGCTCAGGACTCTGACCCAGGACTCTAACCTATACAGCGCACTTCCTAGTGTTTATTCTGCTGA
TGCAGAGCCGCTGGGGTCAGAAACAGGTTCCCAGGAATGGAATACACTCTTCCAGGTCCTCCTCAGCTACCCTCTCCTCT
TCCTACCTTCACCACCACCCCTGAGTCTGCCTGTCTTGGGACAAGCAGAACAGAACGGGAGCCCCCCGGTGCTTCCCACC
CTCCAGCCCAAGCTTGCCTCCTGGGCAGTATTGTTCCCAGAGGAAATGTCCAGTGTAAATAGAGCAGCGGGCAGGCTGGT
GGCGGGAAGGAGATGAAAGGGGCAGTGACAGGGCCGGGGACGGATGGCTTCCTTCCATTGAGGCCTGGCCATGGCGTTTA
TATTTTAGGGAAGAAAGTCAGAGGAATGTTTACATGGACAGGAGTCTGGGGTCAGACCAGTGGAGGGTGTGTGTGTGTGT
TAATCTGTAGGTCCCAAGGCCTTAATAGAAGGGCTGGTTGAAGGTTCGTGGGGACTGGAAGGCAGGCAAGCAGCTCAGCT
CCCAACCCCCTCCTGCCGCCCCAGGCTCACAGGCACACACGGGTACTTATGACCGTATGCCCAGCTTTTGCCGGTGTCTC
ACTGTGTCCTGGGCCCAGACACCTACTTCTCCACTTCCCACCATGGGACCATCAGTAGA
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148299838..148300616 769
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es