Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D187F01
Clone ID D187F01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD187F01
Sequence
CTCTCCCTGCCCACACCCTAATGGTAACTTGAAACCACTATTTGCCCTTAACTCCGCAGCCCCTAAAAAGCACACCAAAT
TGTAAACATAAGGAAGTAGGTTTCTGAGAAACAGACCCCACTGGAGGAAAAAGGCCGGCCCACTGCGCAGCAGGCTCCGG
ACTGCCCAGTTTGAAAAGCCTTCTCATTCCTTCCTTATTCTCACTCTGCAGCTTCAAAAGCCGAGAGATGCCTAAGGAGC
AGCAAGAGGTGGTTGTACTGGGGTCACCCCACATCTCAACTTCTGCGACAGCCACCACAATCAACATGCCTGAGATCTCC
ACGCCTGACCATGTGGTCTGGTCCCTGTTCAATACACTCTTCATGAACTTCTGCTGCCTGGGCTTCGTAGCCTATGCCTA
CTCCGTG
Sequence Type genomic DNA
Unitrap ID UNI29936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148153928..148154334 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es