Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D187D10
Clone ID D187D10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD187D10
Sequence
GATCTGTTTCGGCGGGGCTTGGTTGGGTCTGATTCGGGGGAGACAGCCTTGAAAGTTGAGAGGGGAAGGTTGTTTAGTCC
TAATAGGGAGGGGCGTCAGACTTAAGACCA
Sequence Type genomic DNA
Unitrap ID UNI3664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87561202..87561311 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]


SPLK-Sequence tag 3SD187D10
Sequence
ACCAGAGGGCTTTGCTGAGTCTGNNATGCGAGGCGGTGGTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es