Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D187A12
Clone ID D187A12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD187A12
Sequence
GGCACCTTCTTCCGAGTGGAGGAGGCCTGGGTGGGG
Sequence Type genomic DNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45178600..45178635 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es